Transcript: Human NM_152405.5

Homo sapiens junction mediating and regulatory protein, p53 cofactor (JMY), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
JMY (133746)
Length:
9096
CDS:
521..3487

Additional Resources:

NCBI RefSeq record:
NM_152405.5
NBCI Gene record:
JMY (133746)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152405.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143482 GCACTCGGATTGAAGATGAAT pLKO.1 2442 CDS 100% 5.625 7.875 N JMY n/a
2 TRCN0000144461 CGAGCTGATCAGAAGAAATTT pLKO.1 1895 CDS 100% 15.000 12.000 N JMY n/a
3 TRCN0000139532 CCTTCACACTTCTACCCGATA pLKO.1 3357 CDS 100% 4.050 3.240 N JMY n/a
4 TRCN0000145420 GAACCATGTTCTGTTACCATA pLKO.1 2900 CDS 100% 4.950 3.465 N JMY n/a
5 TRCN0000143251 GCTTGCTGTAAGTTGGAAGAA pLKO.1 3803 3UTR 100% 4.950 3.465 N JMY n/a
6 TRCN0000122843 CGGAGCATCCATGAAGCTCTT pLKO.1 3392 CDS 100% 4.050 2.835 N JMY n/a
7 TRCN0000145292 GCTAAAGAGATATGCTTGGAA pLKO.1 2000 CDS 100% 3.000 2.100 N JMY n/a
8 TRCN0000165025 GTGCTAGGATTATAGGCGTGA pLKO.1 5100 3UTR 100% 2.160 1.080 Y LINC00336 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152405.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13178 pDONR223 100% 62.9% 62.9% None 1_1062del;2346C>T;2429_2464del n/a
2 ccsbBroad304_13178 pLX_304 0% 62.9% 62.9% V5 1_1062del;2346C>T;2429_2464del n/a
Download CSV