Transcript: Human NM_152473.2

Homo sapiens endogenous retrovirus group V member 1, envelope (ERVV-1), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
ERVV-1 (147664)
Length:
2490
CDS:
1..1434

Additional Resources:

NCBI RefSeq record:
NM_152473.2
NBCI Gene record:
ERVV-1 (147664)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152473.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128048 GCTGCACTTAATAGCCTGCTT pLKO.1 1387 CDS 100% 2.640 1.848 N ERVV-1 n/a
2 TRCN0000130073 GATCAGTAAATCCTGTTGCAT pLKO.1 1203 CDS 100% 3.000 1.800 N ERVV-1 n/a
3 TRCN0000128658 CAAACCTCTACACTTGCATTA pLKO.1 842 CDS 100% 10.800 5.400 Y ERVV-1 n/a
4 TRCN0000148928 CCTTTGATGGAAGTCCTAAGA pLKO.1 797 CDS 100% 4.950 2.475 Y ERVV-1 n/a
5 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 2228 3UTR 100% 4.950 2.475 Y GJD4 n/a
6 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 2228 3UTR 100% 4.950 2.475 Y C9orf85 n/a
7 TRCN0000149617 GTACCAGAGATAGCATCTCTA pLKO.1 1085 CDS 100% 0.000 0.000 Y ERVV-1 n/a
8 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 2394 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152473.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13239 pDONR223 100% 68.5% 68.5% None 1_450del n/a
2 ccsbBroad304_13239 pLX_304 0% 68.5% 68.5% V5 1_450del n/a
3 TRCN0000474002 GCCGTTGACTATCTGAGGCGACGA pLX_317 30.3% 68.5% 68.5% V5 1_450del n/a
Download CSV