Transcript: Mouse NM_152803.5

Mus musculus heparanase (Hpse), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Hpse (15442)
Length:
3140
CDS:
123..1730

Additional Resources:

NCBI RefSeq record:
NM_152803.5
NBCI Gene record:
Hpse (15442)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_152803.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098112 GCCGGATGGATTACTTTCCAA pLKO.1 1550 CDS 100% 3.000 4.200 N Hpse n/a
2 TRCN0000098111 CGGATGGATTACTTTCCAAAT pLKO.1 1552 CDS 100% 10.800 8.640 N Hpse n/a
3 TRCN0000098110 AGGCAAATAAGTGGAGGATAT pLKO.1 2009 3UTR 100% 10.800 7.560 N Hpse n/a
4 TRCN0000098114 CCACGATATCAGGAAGGAGAT pLKO.1 1425 CDS 100% 4.050 2.835 N Hpse n/a
5 TRCN0000098113 CCTTGACTACTGCTCTTCCAA pLKO.1 719 CDS 100% 3.000 2.100 N Hpse n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152803.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.