Transcript: Mouse NM_153057.4

Mus musculus nodal modulator 1 (Nomo1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Nomo1 (211548)
Length:
4277
CDS:
137..3781

Additional Resources:

NCBI RefSeq record:
NM_153057.4
NBCI Gene record:
Nomo1 (211548)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153057.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120618 GCTCCTAACAACGGCTACTTT pLKO.1 326 CDS 100% 5.625 7.875 N Nomo1 n/a
2 TRCN0000120619 CGTAATCACTTCCTCCGAGTA pLKO.1 3298 CDS 100% 4.050 5.670 N Nomo1 n/a
3 TRCN0000350207 CGTAATCACTTCCTCCGAGTA pLKO_005 3298 CDS 100% 4.050 5.670 N Nomo1 n/a
4 TRCN0000120617 CCTGCTGAACACAATTTATTT pLKO.1 3968 3UTR 100% 15.000 10.500 N Nomo1 n/a
5 TRCN0000319949 CCTGCTGAACACAATTTATTT pLKO_005 3968 3UTR 100% 15.000 10.500 N Nomo1 n/a
6 TRCN0000120620 CCTGAGAATCGAGCCTGTATT pLKO.1 1063 CDS 100% 13.200 9.240 N Nomo1 n/a
7 TRCN0000350206 CCTGAGAATCGAGCCTGTATT pLKO_005 1063 CDS 100% 13.200 9.240 N Nomo1 n/a
8 TRCN0000120621 CCAGAAGACATGAAGAGACAA pLKO.1 3731 CDS 100% 4.950 3.465 N Nomo1 n/a
9 TRCN0000320022 CCAGAAGACATGAAGAGACAA pLKO_005 3731 CDS 100% 4.950 3.465 N Nomo1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153057.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13680 pDONR223 100% 47.2% 51.7% None (many diffs) n/a
2 ccsbBroad304_13680 pLX_304 0% 47.2% 51.7% V5 (many diffs) n/a
Download CSV