Transcript: Mouse NM_153108.4

Mus musculus defensin beta 8 (Defb8), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Defb8 (244334)
Length:
287
CDS:
14..196

Additional Resources:

NCBI RefSeq record:
NM_153108.4
NBCI Gene record:
Defb8 (244334)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153108.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418755 ACATTCGAAACGGAGGCATAT pLKO_005 105 CDS 100% 10.800 15.120 N Defb8 n/a
2 TRCN0000414670 TATCGGTGCATTGGCCTTAGG pLKO_005 131 CDS 100% 4.050 5.670 N Defb8 n/a
3 TRCN0000438087 GGAACTTGTGGATCTCCTTTC pLKO_005 161 CDS 100% 6.000 4.200 N Defb8 n/a
4 TRCN0000418368 AGGCATAAGATTGGAACTTGT pLKO_005 149 CDS 100% 4.950 3.465 N Defb8 n/a
5 TRCN0000099573 CATATGCCAGTATCGGTGCAT pLKO.1 121 CDS 100% 0.000 0.000 N Defb8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153108.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.