Transcript: Mouse NM_153129.2

Mus musculus phosphofurin acidic cluster sorting protein 1 (Pacs1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Pacs1 (107975)
Length:
4361
CDS:
232..3117

Additional Resources:

NCBI RefSeq record:
NM_153129.2
NBCI Gene record:
Pacs1 (107975)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153129.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346546 CGAACTATCTTGGGCTATAAA pLKO_005 832 CDS 100% 15.000 21.000 N Pacs1 n/a
2 TRCN0000190775 GCCAACTCATGTCAAGCACTT pLKO.1 3060 CDS 100% 4.050 3.240 N Pacs1 n/a
3 TRCN0000346629 GCGAAGGAGAGAAGGTGATAA pLKO_005 2724 CDS 100% 13.200 9.240 N Pacs1 n/a
4 TRCN0000346628 ACCCTAATGAGGGCGCTTTAG pLKO_005 896 CDS 100% 10.800 7.560 N Pacs1 n/a
5 TRCN0000190597 GCCCTCCTGAAACGATTCAAA pLKO.1 1231 CDS 100% 5.625 3.938 N Pacs1 n/a
6 TRCN0000346626 GCCCTCCTGAAACGATTCAAA pLKO_005 1231 CDS 100% 5.625 3.938 N Pacs1 n/a
7 TRCN0000143677 GTGGAGTGACATCAAGTTCTT pLKO.1 3021 CDS 100% 4.950 3.465 N PACS1 n/a
8 TRCN0000346548 GTACCCATAATCCCTGTAATT pLKO_005 3357 3UTR 100% 0.000 0.000 N Pacs1 n/a
9 TRCN0000190397 CCCGGTATTTCTGGGATTGAA pLKO.1 3639 3UTR 100% 5.625 3.375 N Pacs1 n/a
10 TRCN0000201150 CCTAAGATTGTTCTGTGGCTT pLKO.1 3806 3UTR 100% 2.640 1.584 N Pacs1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153129.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.