Transcript: Mouse NM_153179.3

Mus musculus polycystic kidney and hepatic disease 1 (Pkhd1), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Pkhd1 (241035)
Length:
12928
CDS:
230..12409

Additional Resources:

NCBI RefSeq record:
NM_153179.3
NBCI Gene record:
Pkhd1 (241035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153179.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412869 GTTCCTCAATACAGGTATATT pLKO_005 10351 CDS 100% 15.000 21.000 N Pkhd1 n/a
2 TRCN0000200621 CCTGAGATATTCCTATGATTT pLKO.1 6541 CDS 100% 13.200 18.480 N Pkhd1 n/a
3 TRCN0000191008 CCAGAAATCTTATCCGTGTTT pLKO.1 998 CDS 100% 4.950 6.930 N Pkhd1 n/a
4 TRCN0000192855 GCCAACTTAATACCTGTGCTA pLKO.1 12693 3UTR 100% 2.640 3.696 N Pkhd1 n/a
5 TRCN0000191165 CCTTGTGATATTGTGAACTTA pLKO.1 3929 CDS 100% 5.625 4.500 N Pkhd1 n/a
6 TRCN0000425120 CCGGGAAATGAGAGGATTATT pLKO_005 8840 CDS 100% 15.000 10.500 N Pkhd1 n/a
7 TRCN0000420748 TGGAAGTCTCTTGACGATAAA pLKO_005 4978 CDS 100% 13.200 9.240 N Pkhd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153179.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.