Transcript: Human NM_153369.3

Homo sapiens major facilitator superfamily domain containing 4B (MFSD4B), mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
MFSD4B (91749)
Length:
5967
CDS:
363..1919

Additional Resources:

NCBI RefSeq record:
NM_153369.3
NBCI Gene record:
MFSD4B (91749)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153369.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263280 GGGTCGTGCCTTGGGATATTT pLKO_005 479 CDS 100% 15.000 21.000 N MFSD4B n/a
2 TRCN0000263284 CATCAATAGCTACTGGTATTT pLKO_005 1540 CDS 100% 13.200 18.480 N MFSD4B n/a
3 TRCN0000263281 CCCACAGCTGAAGTCTATAAT pLKO_005 1794 CDS 100% 15.000 10.500 N MFSD4B n/a
4 TRCN0000263283 GTTGGAGCTGAGGTAACATAT pLKO_005 1086 CDS 100% 13.200 9.240 N MFSD4B n/a
5 TRCN0000263282 TGGTCTCATACACGTACAATA pLKO_005 2103 3UTR 100% 13.200 9.240 N MFSD4B n/a
6 TRCN0000172465 CCTGCACTCAACCAATCATCT pLKO.1 840 CDS 100% 4.950 3.465 N MFSD4B n/a
7 TRCN0000166922 CTCACTGACATCTTTGAATAA pLKO.1 1933 3UTR 100% 13.200 7.920 N MFSD4B n/a
8 TRCN0000172951 GCAGGCCTTACACTTCTCTTT pLKO.1 728 CDS 100% 4.950 2.970 N MFSD4B n/a
9 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 5379 3UTR 100% 4.950 2.475 Y CFLAR n/a
10 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 5379 3UTR 100% 4.950 2.475 Y C19orf31 n/a
11 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 5434 3UTR 100% 4.050 2.025 Y INTS7 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2360 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 5377 3UTR 100% 4.950 2.475 Y ERN2 n/a
14 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 5377 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 5377 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000168807 GCTGATCTCAAACTCCTGATA pLKO.1 4211 3UTR 100% 4.950 2.475 Y TMEM105 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153369.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.