Transcript: Mouse NM_153390.1

Mus musculus peroxisomal, testis specific 1 (Pxt1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Pxt1 (69307)
Length:
1015
CDS:
144..299

Additional Resources:

NCBI RefSeq record:
NM_153390.1
NBCI Gene record:
Pxt1 (69307)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153390.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184227 GATTCAGGAGCATCTTGCACA pLKO.1 185 CDS 100% 2.640 3.696 N Pxt1 n/a
2 TRCN0000196095 GTCAATCACAGGGTGATTCAG pLKO.1 171 CDS 100% 0.495 0.396 N Pxt1 n/a
3 TRCN0000215843 CATTAAGAACCAACTTCATTA pLKO.1 447 3UTR 100% 13.200 9.240 N Pxt1 n/a
4 TRCN0000183427 CCTGTATCTAGATCTTCATTA pLKO.1 431 3UTR 100% 13.200 9.240 N Pxt1 n/a
5 TRCN0000178864 CTGGAACAACCATTTGCTGTA pLKO.1 278 CDS 100% 4.050 2.835 N Pxt1 n/a
6 TRCN0000179144 GCCCTTTGATCCTGCATTTAT pLKO.1 408 3UTR 100% 15.000 9.000 N Pxt1 n/a
7 TRCN0000184641 CCACCTGTTCCTGGTCTATTT pLKO.1 585 3UTR 100% 13.200 7.920 N Pxt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153390.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.