Transcript: Mouse NM_153422.2

Mus musculus phosphodiesterase 5A, cGMP-specific (Pde5a), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pde5a (242202)
Length:
6728
CDS:
89..2686

Additional Resources:

NCBI RefSeq record:
NM_153422.2
NBCI Gene record:
Pde5a (242202)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153422.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114995 CCTCTCCATTGACGAATATAA pLKO.1 2167 CDS 100% 15.000 10.500 N Pde5a n/a
2 TRCN0000114994 GCCTCTCCATTGACGAATATA pLKO.1 2166 CDS 100% 15.000 10.500 N Pde5a n/a
3 TRCN0000114993 GCGTTGCTCATTGCTGCTTTA pLKO.1 1991 CDS 100% 10.800 7.560 N Pde5a n/a
4 TRCN0000114992 CCGGGACTTTACCTTCTCTTA pLKO.1 169 CDS 100% 4.950 3.465 N Pde5a n/a
5 TRCN0000114991 GCTACCTACTTTCCATCCTTT pLKO.1 2843 3UTR 100% 4.950 3.465 N Pde5a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153422.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.