Transcript: Mouse NM_153505.4

Mus musculus NCK associated protein 1 like (Nckap1l), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Nckap1l (105855)
Length:
4717
CDS:
56..3460

Additional Resources:

NCBI RefSeq record:
NM_153505.4
NBCI Gene record:
Nckap1l (105855)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153505.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112251 GCCATGATTAACCCTGCTAAT pLKO.1 761 CDS 100% 10.800 15.120 N Nckap1l n/a
2 TRCN0000155011 GCCATGATTAACCCTGCTAAT pLKO.1 761 CDS 100% 10.800 15.120 N NCKAP1L n/a
3 TRCN0000112252 GCTTCCAGAATCGTTCGCAAT pLKO.1 2339 CDS 100% 4.050 5.670 N Nckap1l n/a
4 TRCN0000112254 CCAACATAGATGTCCGAAATA pLKO.1 243 CDS 100% 13.200 9.240 N Nckap1l n/a
5 TRCN0000112253 CCATGATTAACCCTGCTAATT pLKO.1 762 CDS 100% 13.200 9.240 N Nckap1l n/a
6 TRCN0000112250 GCAGTGAAAGTTGCAGCCATT pLKO.1 3491 3UTR 100% 4.050 2.835 N Nckap1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153505.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.