Transcript: Human NM_153838.5

Homo sapiens adhesion G protein-coupled receptor F4 (ADGRF4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
ADGRF4 (221393)
Length:
3128
CDS:
232..2319

Additional Resources:

NCBI RefSeq record:
NM_153838.5
NBCI Gene record:
ADGRF4 (221393)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153838.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357111 GGCCCAACCAATGGATCTAAA pLKO_005 2278 CDS 100% 13.200 18.480 N ADGRF4 n/a
2 TRCN0000357110 CCAAATCGATGACCGACAAAG pLKO_005 1409 CDS 100% 10.800 15.120 N ADGRF4 n/a
3 TRCN0000011547 CGAAGTGAAATGCCGCTGTAA pLKO.1 1347 CDS 100% 4.950 6.930 N ADGRF4 n/a
4 TRCN0000011543 CCACTCTCATAGAAGGCACTT pLKO.1 2099 CDS 100% 4.050 5.670 N ADGRF4 n/a
5 TRCN0000368473 GCTTTAAGGAGCATGATTTAT pLKO_005 2509 3UTR 100% 15.000 12.000 N ADGRF4 n/a
6 TRCN0000357107 GGTTTCACATCAACCATAATA pLKO_005 962 CDS 100% 15.000 10.500 N ADGRF4 n/a
7 TRCN0000357077 AGTCTTCCCAGACAGGTAAAT pLKO_005 1162 CDS 100% 13.200 9.240 N ADGRF4 n/a
8 TRCN0000357106 ATGGGTGCCCATTGATCATTG pLKO_005 1799 CDS 100% 10.800 7.560 N ADGRF4 n/a
9 TRCN0000357076 TAGATCCAAGATTCACCTAAA pLKO_005 303 CDS 100% 10.800 7.560 N ADGRF4 n/a
10 TRCN0000011545 CCTCAATTTCTCCATGAGCAT pLKO.1 996 CDS 100% 2.640 1.848 N ADGRF4 n/a
11 TRCN0000011544 GCACCATCTATACCTCTGCAT pLKO.1 565 CDS 100% 2.640 1.848 N ADGRF4 n/a
12 TRCN0000011546 GCTGTAAATCTGATTGTGGTT pLKO.1 1942 CDS 100% 2.640 1.848 N ADGRF4 n/a
13 TRCN0000368472 TCTCAGGATGTGGTCATAATT pLKO_005 2011 CDS 100% 15.000 9.000 N ADGRF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153838.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.