Transcript: Mouse NM_170757.1

Mus musculus coiled-coil domain containing 186 (Ccdc186), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Ccdc186 (213993)
Length:
2754
CDS:
1..2754

Additional Resources:

NCBI RefSeq record:
NM_170757.1
NBCI Gene record:
Ccdc186 (213993)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_170757.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374547 ATGGGACAGGCTAACCGTAAT pLKO_005 1945 CDS 100% 10.800 8.640 N Ccdc186 n/a
2 TRCN0000173232 CGGAGAAAGTTAGAGCAGACT pLKO.1 2161 CDS 100% 2.640 2.112 N Ccdc186 n/a
3 TRCN0000345316 GAGAATGGAAACCACGATAAA pLKO_005 2182 CDS 100% 13.200 9.240 N Ccdc186 n/a
4 TRCN0000345245 GAGTTCATCAGGGTCACTTAA pLKO_005 2229 CDS 100% 13.200 9.240 N Ccdc186 n/a
5 TRCN0000374603 GTCTAGAAGATGAACGCTTAA pLKO_005 1577 CDS 100% 10.800 7.560 N Ccdc186 n/a
6 TRCN0000345315 GTTTCAGCCTCAGACGATTTG pLKO_005 520 CDS 100% 10.800 7.560 N Ccdc186 n/a
7 TRCN0000176310 CAGTTACATGAGCAGCTTCAA pLKO.1 1690 CDS 100% 4.950 3.465 N Ccdc186 n/a
8 TRCN0000345244 CAGTTACATGAGCAGCTTCAA pLKO_005 1690 CDS 100% 4.950 3.465 N Ccdc186 n/a
9 TRCN0000173167 CGAGAAGAATCAGGCACACTT pLKO.1 2473 CDS 100% 4.950 3.465 N Ccdc186 n/a
10 TRCN0000194046 GCAGCAACTCTATGAATCGAA pLKO.1 1137 CDS 100% 3.000 2.100 N Ccdc186 n/a
11 TRCN0000122439 GAGAAGAATCAGGCACACTTT pLKO.1 2474 CDS 100% 4.950 2.970 N CCDC186 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_170757.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.