Transcript: Mouse NM_170758.3

Mus musculus CD300A molecule (Cd300a), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cd300a (217303)
Length:
4642
CDS:
325..1281

Additional Resources:

NCBI RefSeq record:
NM_170758.3
NBCI Gene record:
Cd300a (217303)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_170758.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101050 GCCACTTCTTACAACTCTTAA pLKO.1 2560 3UTR 100% 13.200 18.480 N Cd300a n/a
2 TRCN0000101051 GCCACCGTGAACATGACTATT pLKO.1 839 CDS 100% 13.200 9.240 N Cd300a n/a
3 TRCN0000101053 CCTGAGTGTGTCATGTCGATA pLKO.1 447 CDS 100% 4.950 3.465 N Cd300a n/a
4 TRCN0000101052 GCCAATGGAGATTCTCTTCAT pLKO.1 1186 CDS 100% 4.950 3.465 N Cd300a n/a
5 TRCN0000101054 TGAGCAGAATGAGTGCCAGTA pLKO.1 1014 CDS 100% 4.050 2.835 N Cd300a n/a
6 TRCN0000200412 GCTGGCTTACAGTTCAGAGAT pLKO.1 2962 3UTR 100% 4.950 2.475 Y Lactb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_170758.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.