Transcript: Mouse NM_170779.1

Mus musculus WW, C2 and coiled-coil domain containing 1 (Wwc1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Wwc1 (211652)
Length:
3315
CDS:
1..3315

Additional Resources:

NCBI RefSeq record:
NM_170779.1
NBCI Gene record:
Wwc1 (211652)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_170779.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341161 CCAGTATGTGTGTCGGCTAAA pLKO_005 2784 CDS 100% 10.800 15.120 N Wwc1 n/a
2 TRCN0000178675 CAGAAAGTGAACATCCGTGTA pLKO.1 2083 CDS 100% 4.050 5.670 N Wwc1 n/a
3 TRCN0000352550 CAGAAAGTGAACATCCGTGTA pLKO_005 2083 CDS 100% 4.050 5.670 N Wwc1 n/a
4 TRCN0000182102 CCTCGTGTTCAATGAGGCATT pLKO.1 2172 CDS 100% 4.050 3.240 N Wwc1 n/a
5 TRCN0000177135 GAGATCCTGAAAGCTGAAATT pLKO.1 472 CDS 100% 13.200 9.240 N Wwc1 n/a
6 TRCN0000341228 GAGATCCTGAAAGCTGAAATT pLKO_005 472 CDS 100% 13.200 9.240 N Wwc1 n/a
7 TRCN0000172906 GACGGCAAGGTCTACTACATA pLKO.1 55 CDS 100% 5.625 3.938 N WWC1 n/a
8 TRCN0000176876 GATTACTTCATAGACCACAAT pLKO.1 205 CDS 100% 4.950 3.465 N Wwc1 n/a
9 TRCN0000341160 GATTACTTCATAGACCACAAT pLKO_005 205 CDS 100% 4.950 3.465 N Wwc1 n/a
10 TRCN0000178085 GCAGTGACAGTGATAGTTCTA pLKO.1 2807 CDS 100% 4.950 3.465 N Wwc1 n/a
11 TRCN0000200153 CAGGAGTATCAGCAGTTGCAT pLKO.1 376 CDS 100% 3.000 2.100 N Wwc1 n/a
12 TRCN0000177134 GAAGTTAAATAGCAAGAGGAA pLKO.1 1188 CDS 100% 2.640 1.848 N Wwc1 n/a
13 TRCN0000182682 GAGATGGTTCACCTACAGCAT pLKO.1 529 CDS 100% 2.640 1.848 N Wwc1 n/a
14 TRCN0000200207 CCTCATTAAGAGTCTCGCCAT pLKO.1 711 CDS 100% 2.160 1.512 N Wwc1 n/a
15 TRCN0000341162 CAGCTTCACTGACCTCTATTA pLKO_005 1380 CDS 100% 13.200 7.920 N Wwc1 n/a
16 TRCN0000182717 CCAGCATTAAAGGTGGACAGA pLKO.1 2623 CDS 100% 2.640 1.584 N Wwc1 n/a
17 TRCN0000243362 TCTCTGCAGATGACGTCTAAT pLKO_005 3296 CDS 100% 13.200 18.480 N WWC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_170779.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.