Transcript: Human NM_170782.3

Homo sapiens potassium calcium-activated channel subfamily N member 3 (KCNN3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
KCNN3 (3782)
Length:
11966
CDS:
165..1445

Additional Resources:

NCBI RefSeq record:
NM_170782.3
NBCI Gene record:
KCNN3 (3782)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_170782.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422913 AGACCGAGCTAATTAACTAAC pLKO_005 1557 3UTR 100% 10.800 15.120 N KCNN3 n/a
2 TRCN0000043895 CGTACACAAGTTCAAGCAGTT pLKO.1 1420 CDS 100% 4.050 5.670 N KCNN3 n/a
3 TRCN0000043896 GCAGGACGTAACTAGTAACTT pLKO.1 710 CDS 100% 0.000 0.000 N KCNN3 n/a
4 TRCN0000426675 AGCGGAGAAGCACGTTCATAA pLKO_005 899 CDS 100% 13.200 9.240 N KCNN3 n/a
5 TRCN0000043893 CCTTCGGGAAACATGGTTAAT pLKO.1 974 CDS 100% 13.200 9.240 N KCNN3 n/a
6 TRCN0000421064 AGAATGTCATGTATGACTTAA pLKO_005 1153 CDS 100% 13.200 7.920 N KCNN3 n/a
7 TRCN0000180546 GCCTGTAATCCCAGGACTTTA pLKO.1 4371 3UTR 100% 13.200 6.600 Y PRR11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_170782.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.