Transcript: Human NM_172056.2

Homo sapiens potassium voltage-gated channel subfamily H member 2 (KCNH2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
KCNH2 (3757)
Length:
3558
CDS:
402..3068

Additional Resources:

NCBI RefSeq record:
NM_172056.2
NBCI Gene record:
KCNH2 (3757)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021715 CCGTAAGTTCATCATCGCCAA pLKO.1 479 CDS 100% 2.160 3.024 N KCNH2 n/a
2 TRCN0000068385 CCCTCCATCAAGGACAAGTAT pLKO.1 2214 CDS 100% 5.625 3.938 N Kcnh2 n/a
3 TRCN0000021718 CAAAGTGGAAATCGCCTTCTA pLKO.1 677 CDS 100% 4.950 3.465 N KCNH2 n/a
4 TRCN0000429152 CAGATAGGCAAACCCTACAAC pLKO_005 2175 CDS 100% 4.950 3.465 N KCNH2 n/a
5 TRCN0000021716 CCGTGAGATCATAGCACCTAA pLKO.1 1466 CDS 100% 4.950 3.465 N KCNH2 n/a
6 TRCN0000021717 CCTCATGTATGCTAGCATCTT pLKO.1 2348 CDS 100% 4.950 3.465 N KCNH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.