Transcript: Human NM_172194.1

Homo sapiens olfactory receptor family 4 subfamily Q member 3 (OR4Q3), mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
OR4Q3 (441669)
Length:
942
CDS:
1..942

Additional Resources:

NCBI RefSeq record:
NM_172194.1
NBCI Gene record:
OR4Q3 (441669)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172194.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000188592 GCCCAATGAACTGGACAACTT pLKO.1 513 CDS 100% 4.950 6.930 N OR4Q3 n/a
2 TRCN0000187364 CAGCTTCTCTGTGGATAAGAT pLKO.1 792 CDS 100% 5.625 3.938 N OR4Q3 n/a
3 TRCN0000584097 TCTATCATGCAGGTCATACTA pLKO_005 469 CDS 100% 5.625 3.938 N OR4Q3 n/a
4 TRCN0000204330 CATCTGTAACCCTTTGCGCTA pLKO.1 378 CDS 100% 2.160 1.512 N OR4Q3 n/a
5 TRCN0000187257 CCTCTTGATAGTGGTAACAGT pLKO.1 126 CDS 100% 3.000 1.500 Y OR4Q3 n/a
6 TRCN0000187703 GCCATCTGTAACCCTTTGCTT pLKO.1 376 CDS 100% 3.000 1.500 Y Olfr971 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172194.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.