Transcript: Human NM_172238.3

Homo sapiens transcription factor AP-2 delta (TFAP2D), mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
TFAP2D (83741)
Length:
2040
CDS:
513..1871

Additional Resources:

NCBI RefSeq record:
NM_172238.3
NBCI Gene record:
TFAP2D (83741)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172238.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434236 GCTTTGGGACTCCGGCAATAT pLKO_005 1666 CDS 100% 13.200 18.480 N TFAP2D n/a
2 TRCN0000424257 ATACGTCACGACGGATCAAAC pLKO_005 552 CDS 100% 10.800 15.120 N Tfap2d n/a
3 TRCN0000019710 CGACTTTATTAACCTGCACAA pLKO.1 845 CDS 100% 4.050 5.670 N TFAP2D n/a
4 TRCN0000431871 CCAATTCCACTGTCGCCTATT pLKO_005 613 CDS 100% 10.800 8.640 N TFAP2D n/a
5 TRCN0000019712 GCTTAAACTTACCAGCAGGAA pLKO.1 1330 CDS 100% 2.640 2.112 N TFAP2D n/a
6 TRCN0000019713 CCAGAGACATTTAACACATTT pLKO.1 1628 CDS 100% 13.200 9.240 N TFAP2D n/a
7 TRCN0000019711 GCGACCAAACAAATCTGTAAA pLKO.1 1530 CDS 100% 13.200 9.240 N TFAP2D n/a
8 TRCN0000430442 AGTCCTTCCATTACGAGTTTC pLKO_005 727 CDS 100% 10.800 7.560 N TFAP2D n/a
9 TRCN0000086527 GACTTTATTAACCTGCACAAT pLKO.1 846 CDS 100% 4.950 3.465 N Tfap2d n/a
10 TRCN0000019709 CGGATCAAACAGCTACCGTTT pLKO.1 563 CDS 100% 4.050 2.835 N TFAP2D n/a
11 TRCN0000086525 CCTCTCCTTTAACTTACTCTA pLKO.1 640 CDS 100% 4.950 3.465 N Tfap2d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172238.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.