Transcript: Mouse NM_172274.2

Mus musculus coiled-coil and C2 domain containing 2A (Cc2d2a), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cc2d2a (231214)
Length:
5463
CDS:
432..5333

Additional Resources:

NCBI RefSeq record:
NM_172274.2
NBCI Gene record:
Cc2d2a (231214)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172274.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197491 CCCATTTAGCACCATCTATTT pLKO.1 4013 CDS 100% 13.200 18.480 N Cc2d2a n/a
2 TRCN0000178278 GTTCCGTGATTCTGTACGAAA pLKO.1 935 CDS 100% 4.950 6.930 N Cc2d2a n/a
3 TRCN0000181757 GACCCGAAACTAGATGAGGAT pLKO.1 2049 CDS 100% 2.640 3.696 N Cc2d2a n/a
4 TRCN0000449001 TGCAGAAGAGGCCTATAATTT pLKO_005 995 CDS 100% 15.000 10.500 N Cc2d2a n/a
5 TRCN0000448801 GCAAGGATTGATGGCACATTT pLKO_005 4038 CDS 100% 13.200 9.240 N Cc2d2a n/a
6 TRCN0000177905 CCAAGATTCCTGGAAGATGAA pLKO.1 1347 CDS 100% 4.950 3.465 N Cc2d2a n/a
7 TRCN0000197895 GCTATGCAATTACTTTCTGTT pLKO.1 4583 CDS 100% 4.950 3.465 N Cc2d2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172274.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.