Transcript: Mouse NM_172286.4

Mus musculus RIKEN cDNA 6430548M08 gene (6430548M08Rik), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
6430548M08Rik (234797)
Length:
5565
CDS:
299..1522

Additional Resources:

NCBI RefSeq record:
NM_172286.4
NBCI Gene record:
6430548M08Rik (234797)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172286.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178401 GCCCTAGAACTAGCAGTTAAA pLKO.1 1610 3UTR 100% 13.200 9.240 N 6430548M08Rik n/a
2 TRCN0000198920 GCTCTCTCTCATCTGTCTCTT pLKO.1 3136 3UTR 100% 4.950 3.465 N 6430548M08Rik n/a
3 TRCN0000198241 GCTGTGATTGGCAATCTAGAT pLKO.1 1448 CDS 100% 4.950 3.465 N 6430548M08Rik n/a
4 TRCN0000198082 CAGTATTGACTCCTACCTGAA pLKO.1 919 CDS 100% 4.050 2.835 N 6430548M08Rik n/a
5 TRCN0000182048 CAATGAGTCCTTCTCCTCCAA pLKO.1 520 CDS 100% 2.640 1.848 N 6430548M08Rik n/a
6 TRCN0000178177 GAAGAGCAATACAAGCTGCTA pLKO.1 1469 CDS 100% 2.640 1.848 N 6430548M08Rik n/a
7 TRCN0000135652 GAAGAGCAATACAAGCTGCTT pLKO.1 1469 CDS 100% 2.640 1.848 N KIAA0513 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172286.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.