Transcript: Human NM_172367.3

Homo sapiens trafficking regulator of GLUT4 (SLC2A4) 1 (TRARG1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TRARG1 (286753)
Length:
3588
CDS:
341..874

Additional Resources:

NCBI RefSeq record:
NM_172367.3
NBCI Gene record:
TRARG1 (286753)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172367.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038120 CGTCAACTTCACAGTTCAGAA pLKO.1 847 CDS 100% 4.950 3.960 N TRARG1 n/a
2 TRCN0000038119 GCTCAGCATTACCCTCATCAT pLKO.1 793 CDS 100% 4.950 3.465 N TRARG1 n/a
3 TRCN0000038121 CATCATGTCTCGAAGCAGCAT pLKO.1 721 CDS 100% 2.640 1.848 N TRARG1 n/a
4 TRCN0000038122 CCTGAATCTGTCCAAGACCCT pLKO.1 460 CDS 100% 0.660 0.462 N TRARG1 n/a
5 TRCN0000038123 CGTCATTATCATGGTGGCCGT pLKO.1 823 CDS 100% 0.540 0.378 N TRARG1 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3061 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172367.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13570 pDONR223 100% 99% 97.7% None (many diffs) n/a
2 ccsbBroad304_13570 pLX_304 0% 99% 97.7% V5 (many diffs) n/a
Download CSV