Transcript: Mouse NM_172409.2

Mus musculus formin-like 2 (Fmnl2), mRNA.

Source:
NCBI, updated 2017-04-16
Taxon:
Mus musculus (mouse)
Gene:
Fmnl2 (71409)
Length:
5851
CDS:
276..3527

Additional Resources:

NCBI RefSeq record:
NM_172409.2
NBCI Gene record:
Fmnl2 (71409)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172409.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251746 CATTCTGCACTTCGATATAAT pLKO_005 858 CDS 100% 15.000 21.000 N Fmnl2 n/a
2 TRCN0000251747 TTATCCGCGATAGGGTTAAAT pLKO_005 4582 3UTR 100% 15.000 21.000 N Fmnl2 n/a
3 TRCN0000251748 CAAACACTGTTGCACTATATA pLKO_005 2853 CDS 100% 15.000 10.500 N Fmnl2 n/a
4 TRCN0000369345 CAAACACTGTTGCACTATATA pLKO_005 2853 CDS 100% 15.000 10.500 N FMNL2 n/a
5 TRCN0000251750 CCTCAACTTCACGCAATTATA pLKO_005 2670 CDS 100% 15.000 10.500 N Fmnl2 n/a
6 TRCN0000364655 CTGTTAATGGTGCCGAAATAA pLKO_005 3570 3UTR 100% 15.000 10.500 N FMNL2 n/a
7 TRCN0000251749 GATGTTCTTGTGGAGTATTTG pLKO_005 675 CDS 100% 13.200 9.240 N Fmnl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172409.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13038 pDONR223 100% 14.3% 14.9% None (many diffs) n/a
2 ccsbBroad304_13038 pLX_304 0% 14.3% 14.9% V5 (many diffs) n/a
Download CSV