Transcript: Mouse NM_172414.4

Mus musculus zinc finger, C2HC-type containing 1C (Zc2hc1c), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Zc2hc1c (72350)
Length:
4482
CDS:
215..1798

Additional Resources:

NCBI RefSeq record:
NM_172414.4
NBCI Gene record:
Zc2hc1c (72350)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172414.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181820 GAGCTACAAAGGATGGTACTA pLKO.1 986 CDS 100% 4.950 6.930 N Zc2hc1c n/a
2 TRCN0000178333 GCGTTATGTTCCCACATAATA pLKO.1 252 CDS 100% 1.500 2.100 N Zc2hc1c n/a
3 TRCN0000182306 GCACAGAACTAGAGCAGTACT pLKO.1 1476 CDS 100% 4.950 3.960 N Zc2hc1c n/a
4 TRCN0000178677 CTTACGAACAAAGTGACTCTT pLKO.1 312 CDS 100% 4.950 3.465 N Zc2hc1c n/a
5 TRCN0000181798 GCAAATGACCAGGACTTCATT pLKO.1 572 CDS 100% 0.563 0.394 N Zc2hc1c n/a
6 TRCN0000216976 CTGATGGCCAGTAACAGTAAA pLKO.1 1190 CDS 100% 13.200 7.920 N Zc2hc1c n/a
7 TRCN0000182640 GAGACAGAAGCACGAGTCTTT pLKO.1 1561 CDS 100% 4.950 2.970 N Zc2hc1c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172414.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.