Transcript: Mouse NM_172486.2

Mus musculus zinc finger protein 677 (Zfp677), mRNA.

Source:
NCBI, updated 2017-04-28
Taxon:
Mus musculus (mouse)
Gene:
Zfp677 (210503)
Length:
2916
CDS:
330..2234

Additional Resources:

NCBI RefSeq record:
NM_172486.2
NBCI Gene record:
Zfp677 (210503)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172486.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084957 CCTCAGTTATCAACCCTTAAA pLKO.1 2088 CDS 100% 13.200 18.480 N Zfp677 n/a
2 TRCN0000414664 TATTCCTACCATTCGTCATTT pLKO_005 2184 CDS 100% 13.200 17.160 N Zfp677 n/a
3 TRCN0000084955 CGTTCCAACATTAGTCAAGAT pLKO.1 753 CDS 100% 4.950 3.960 N Zfp677 n/a
4 TRCN0000423527 AGCTCTACAAGTGCAACATTT pLKO_005 1969 CDS 100% 13.200 9.240 N Zfp677 n/a
5 TRCN0000084953 GACTGGAAAGAAACAACTATA pLKO.1 2561 3UTR 100% 13.200 9.240 N Zfp677 n/a
6 TRCN0000084954 CGTGCAATGTTTGTGACAGAT pLKO.1 1222 CDS 100% 4.950 3.465 N Zfp677 n/a
7 TRCN0000084956 GCAAATCCTTTAACAGTTGTA pLKO.1 1489 CDS 100% 4.950 3.465 N Zfp677 n/a
8 TRCN0000423291 ACTGGAAAGAAACCCTATAAG pLKO_005 1455 CDS 100% 13.200 7.920 N Zfp677 n/a
9 TRCN0000414967 TGACTCACCAAACGCAGATAG pLKO_005 665 CDS 100% 10.800 6.480 N Zfp677 n/a
10 TRCN0000230529 ACTGGAAAGAAACCCTATAAA pLKO_005 1455 CDS 100% 15.000 9.000 N ZNF99 n/a
11 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 952 CDS 100% 13.200 6.600 Y Zfp934 n/a
12 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 952 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
13 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 952 CDS 100% 13.200 6.600 Y EG668616 n/a
14 TRCN0000240039 TGATGTTGGAGAATTACAATA pLKO_005 451 CDS 100% 13.200 6.600 Y Zfp991 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172486.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.