Transcript: Mouse NM_172495.5

Mus musculus nuclear receptor coactivator 7 (Ncoa7), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ncoa7 (211329)
Length:
5134
CDS:
342..3173

Additional Resources:

NCBI RefSeq record:
NM_172495.5
NBCI Gene record:
Ncoa7 (211329)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172495.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201060 CCGATCCCTTAGTGATTGAAA pLKO.1 1111 CDS 100% 5.625 7.875 N Ncoa7 n/a
2 TRCN0000217804 CATCAGGCCGATCACTATATT pLKO.1 4678 3UTR 100% 15.000 12.000 N Ncoa7 n/a
3 TRCN0000190323 CGATTTGGTCTGTGGCTAGAT pLKO.1 3042 CDS 100% 4.950 3.960 N Ncoa7 n/a
4 TRCN0000241626 AGTAGTCTATCGCGAATTATT pLKO_005 4534 3UTR 100% 15.000 10.500 N Ncoa7 n/a
5 TRCN0000241624 GACATGGATAACCAGATATTT pLKO_005 2853 CDS 100% 15.000 10.500 N Ncoa7 n/a
6 TRCN0000241625 AGCTGAACATGATCGACAATT pLKO_005 2530 CDS 100% 13.200 9.240 N Ncoa7 n/a
7 TRCN0000191030 CAACTCTGAATTGTGGAAATT pLKO.1 1448 CDS 100% 13.200 9.240 N Ncoa7 n/a
8 TRCN0000241622 CAAGTTCAGTGACCACTATTA pLKO_005 2897 CDS 100% 13.200 9.240 N Ncoa7 n/a
9 TRCN0000365163 CAAGTTCAGTGACCACTATTA pLKO_005 2897 CDS 100% 13.200 9.240 N NCOA7 n/a
10 TRCN0000217816 CTACACCTTTAGTCCGAATTT pLKO.1 2939 CDS 100% 13.200 9.240 N Ncoa7 n/a
11 TRCN0000241623 ACCCATCGAGAGGGTCTTATC pLKO_005 953 CDS 100% 10.800 7.560 N Ncoa7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172495.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.