Transcript: Mouse NM_172499.2

Mus musculus major facilitator superfamily domain containing 9 (Mfsd9), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Mfsd9 (211798)
Length:
3152
CDS:
39..1439

Additional Resources:

NCBI RefSeq record:
NM_172499.2
NBCI Gene record:
Mfsd9 (211798)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172499.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101986 CGTCATGCTGTACTACAGTAA pLKO.1 908 CDS 100% 4.950 6.930 N Mfsd9 n/a
2 TRCN0000101989 GTAGGCTTCTTGGACCTGTTT pLKO.1 162 CDS 100% 4.950 3.960 N Mfsd9 n/a
3 TRCN0000101987 CCACCAATGTGTTCCTGTTTA pLKO.1 394 CDS 100% 13.200 9.240 N Mfsd9 n/a
4 TRCN0000434739 GTCATGCTGTACTACAGTAAC pLKO_005 909 CDS 100% 10.800 7.560 N MFSD9 n/a
5 TRCN0000101988 CATGCTGTACTACAGTAACTT pLKO.1 911 CDS 100% 5.625 3.938 N Mfsd9 n/a
6 TRCN0000101985 CCAAGAAGTTTCTCTGCCCAA pLKO.1 1814 3UTR 100% 2.160 1.512 N Mfsd9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172499.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.