Transcript: Mouse NM_172501.2

Mus musculus NHL repeat containing 3 (Nhlrc3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Nhlrc3 (212114)
Length:
1560
CDS:
116..1159

Additional Resources:

NCBI RefSeq record:
NM_172501.2
NBCI Gene record:
Nhlrc3 (212114)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184603 GATTCCCTCAACGGGTTAGTT pLKO.1 320 CDS 100% 5.625 7.875 N Nhlrc3 n/a
2 TRCN0000161732 CGAGCCTGGAATTATACAGTT pLKO.1 407 CDS 100% 4.950 3.465 N NHLRC3 n/a
3 TRCN0000184167 CCTGCCAAGTTCAACATACCT pLKO.1 743 CDS 100% 3.000 2.100 N Nhlrc3 n/a
4 TRCN0000184078 CGAGGAAATAAGAGGCTCCAA pLKO.1 809 CDS 100% 2.640 1.848 N Nhlrc3 n/a
5 TRCN0000180120 CTCATCACTTCCTAAGTGCTA pLKO.1 1330 3UTR 100% 2.640 1.848 N Nhlrc3 n/a
6 TRCN0000160403 CCCAAGATTTCATGATCCTTT pLKO.1 696 CDS 100% 4.950 6.930 N NHLRC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.