Transcript: Mouse NM_172503.3

Mus musculus zinc finger SWIM-type containing 4 (Zswim4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Zswim4 (212168)
Length:
4348
CDS:
39..3344

Additional Resources:

NCBI RefSeq record:
NM_172503.3
NBCI Gene record:
Zswim4 (212168)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172503.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199003 GCACTTCACATCAGGGTAGTT pLKO.1 3702 3UTR 100% 4.950 6.930 N Zswim4 n/a
2 TRCN0000181513 GCGCAATGAAGAACAGCTACT pLKO.1 1850 CDS 100% 4.050 5.670 N Zswim4 n/a
3 TRCN0000198374 GAAGAACTGGTACTCCTTGTT pLKO.1 2510 CDS 100% 4.950 3.960 N Zswim4 n/a
4 TRCN0000177724 CATGAAGAACTGGTACTCCTT pLKO.1 2507 CDS 100% 2.640 1.848 N Zswim4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172503.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.