Transcript: Mouse NM_172522.4

Mus musculus multiple EGF-like-domains 11 (Megf11), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Megf11 (214058)
Length:
3669
CDS:
210..3053

Additional Resources:

NCBI RefSeq record:
NM_172522.4
NBCI Gene record:
Megf11 (214058)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172522.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119476 CCGGCTACTATGGCAACGGTT pLKO.1 1300 CDS 100% 0.880 1.232 N Megf11 n/a
2 TRCN0000119474 GAACACATACATTATGGACAA pLKO.1 3008 CDS 100% 4.050 3.240 N Megf11 n/a
3 TRCN0000119475 AGGACCCTTATGTCAGAGAAT pLKO.1 1916 CDS 100% 4.950 3.465 N Megf11 n/a
4 TRCN0000119472 GCCAGCTAAATGTCTTCAGAA pLKO.1 3080 3UTR 100% 4.950 3.465 N Megf11 n/a
5 TRCN0000119473 GCTATGTGAGTGCATGAACAA pLKO.1 2366 CDS 100% 4.950 3.465 N Megf11 n/a
6 TRCN0000154867 GCTGAATCCCTACACCAAGAT pLKO.1 2477 CDS 100% 4.950 3.465 N MEGF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172522.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.