Transcript: Mouse NM_172540.2

Mus musculus TRM2 tRNA methyltransferase 2B (Trmt2b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Trmt2b (215201)
Length:
3261
CDS:
156..1637

Additional Resources:

NCBI RefSeq record:
NM_172540.2
NBCI Gene record:
Trmt2b (215201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172540.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429163 ACTATGCTGTCCTCCAAATTC pLKO_005 1511 CDS 100% 13.200 18.480 N Trmt2b n/a
2 TRCN0000424049 TAACTCCTTGAACCTGAATTT pLKO_005 1839 3UTR 100% 13.200 18.480 N Trmt2b n/a
3 TRCN0000436812 TGCCCGAGCTGGATTGCATTA pLKO_005 1394 CDS 100% 10.800 15.120 N Trmt2b n/a
4 TRCN0000104023 GCACAACTCAAGGTGAAATTT pLKO.1 414 CDS 100% 15.000 12.000 N Trmt2b n/a
5 TRCN0000428944 GGGTTTGAAGATTCGAATTTC pLKO_005 1052 CDS 100% 13.200 9.240 N Trmt2b n/a
6 TRCN0000434498 GAGCCTCCTCCTAGACATTTG pLKO_005 1157 CDS 100% 10.800 7.560 N Trmt2b n/a
7 TRCN0000104020 CCTGAGTTTGATTGTTAGTAT pLKO.1 2747 3UTR 100% 5.625 3.938 N Trmt2b n/a
8 TRCN0000104022 GCTGTACCTGTGGATTTGTTT pLKO.1 1572 CDS 100% 5.625 3.938 N Trmt2b n/a
9 TRCN0000104021 CCTCGCTCTATTTCCAGGAAA pLKO.1 952 CDS 100% 4.950 3.465 N Trmt2b n/a
10 TRCN0000104024 GCAGAGCATATAAAGGGAGTT pLKO.1 262 CDS 100% 4.050 2.835 N Trmt2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172540.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.