Transcript: Mouse NM_172574.2

Mus musculus PQ loop repeat containing (Pqlc3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pqlc3 (217430)
Length:
1928
CDS:
164..772

Additional Resources:

NCBI RefSeq record:
NM_172574.2
NBCI Gene record:
Pqlc3 (217430)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172574.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250457 CACTCAAGCTGCCGCAGATTT pLKO_005 219 CDS 100% 13.200 18.480 N Pqlc3 n/a
2 TRCN0000258059 TTACCCTACATGGCCGTATTT pLKO_005 443 CDS 100% 13.200 18.480 N Pqlc3 n/a
3 TRCN0000250458 TTAGTGCAGCCAGTAAGTTTG pLKO_005 534 CDS 100% 10.800 15.120 N Pqlc3 n/a
4 TRCN0000179281 GCAGAAATGGATCATCGACTT pLKO.1 490 CDS 100% 4.050 5.670 N Pqlc3 n/a
5 TRCN0000250456 CTAGCCAATTCTTAGGTATTT pLKO_005 1692 3UTR 100% 13.200 10.560 N Pqlc3 n/a
6 TRCN0000183350 GCAGTTTAACTCTTCCATAAA pLKO.1 1400 3UTR 100% 13.200 9.240 N Pqlc3 n/a
7 TRCN0000250455 TTCGTTATCAGCATTACTATG pLKO_005 321 CDS 100% 10.800 7.560 N Pqlc3 n/a
8 TRCN0000183351 GCAGGTTTGTTAAACTTGAAA pLKO.1 890 3UTR 100% 5.625 3.938 N Pqlc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172574.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09529 pDONR223 100% 83% 85.1% None (many diffs) n/a
Download CSV