Transcript: Mouse NM_172757.3

Mus musculus HEAT repeat containing 3 (Heatr3), mRNA.

Source:
NCBI, updated 2019-02-16
Taxon:
Mus musculus (mouse)
Gene:
Heatr3 (234549)
Length:
3190
CDS:
136..2175

Additional Resources:

NCBI RefSeq record:
NM_172757.3
NBCI Gene record:
Heatr3 (234549)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172757.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176106 GCTGGGCTTTAAGGTATTCAA pLKO.1 2440 3UTR 100% 5.625 7.875 N Heatr3 n/a
2 TRCN0000152833 GAACCCTACTTGGAAACCTTT pLKO.1 1476 CDS 100% 4.950 6.930 N HEATR3 n/a
3 TRCN0000173284 GCTAACGGTGATGACTTGGTT pLKO.1 1078 CDS 100% 3.000 4.200 N Heatr3 n/a
4 TRCN0000215669 GAGTCAGGCAGAAATCATTAA pLKO.1 933 CDS 100% 13.200 10.560 N Heatr3 n/a
5 TRCN0000217775 CAGACTGCTCTGGAAGTTATT pLKO.1 1222 CDS 100% 13.200 9.240 N Heatr3 n/a
6 TRCN0000175541 CGAGTGAATGTGGTCAGTATT pLKO.1 1798 CDS 100% 13.200 9.240 N Heatr3 n/a
7 TRCN0000193592 GAGTGAATGTGGTCAGTATTT pLKO.1 1799 CDS 100% 13.200 9.240 N Heatr3 n/a
8 TRCN0000175899 GCTGAGAATACTGAAGGGTTT pLKO.1 2305 3UTR 100% 4.050 2.835 N Heatr3 n/a
9 TRCN0000193604 GCTGATAAGAGAAATCCTGTA pLKO.1 580 CDS 100% 4.050 2.835 N Heatr3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172757.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08456 pDONR223 100% 84.4% 86.1% None (many diffs) n/a
2 ccsbBroad304_08456 pLX_304 0% 84.4% 86.1% V5 (many diffs) n/a
Download CSV