Transcript: Mouse NM_172770.3

Mus musculus tetratricopeptide repeat domain 12 (Ttc12), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ttc12 (235330)
Length:
3630
CDS:
96..2210

Additional Resources:

NCBI RefSeq record:
NM_172770.3
NBCI Gene record:
Ttc12 (235330)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172770.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250688 TGCATCACGTTACGCCATAAA pLKO_005 1823 CDS 100% 13.200 18.480 N Ttc12 n/a
2 TRCN0000250685 TACTGGCTATCTGCACGAACA pLKO_005 1846 CDS 100% 4.050 3.240 N Ttc12 n/a
3 TRCN0000250689 TGCAGCACTCAGCCCTATAAA pLKO_005 2586 3UTR 100% 15.000 10.500 N Ttc12 n/a
4 TRCN0000250686 GAAGTAGTGAGACTTGATAAA pLKO_005 1887 CDS 100% 13.200 9.240 N Ttc12 n/a
5 TRCN0000183640 GCAGATATTGTCTTCACTATA pLKO.1 3435 3UTR 100% 13.200 9.240 N Ttc12 n/a
6 TRCN0000178898 CAGCAAGGCTAAAGAATGTTA pLKO.1 662 CDS 100% 5.625 3.938 N Ttc12 n/a
7 TRCN0000250687 GACAGCAGGAGTGGTCAAGAA pLKO_005 1769 CDS 100% 4.950 3.465 N Ttc12 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2242 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172770.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.