Transcript: Mouse NM_172819.3

Mus musculus disco interacting protein 2 homolog B (Dip2b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Dip2b (239667)
Length:
8127
CDS:
62..4084

Additional Resources:

NCBI RefSeq record:
NM_172819.3
NBCI Gene record:
Dip2b (239667)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172819.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098719 CGTGTGTCCTTACCACTCAAA pLKO.1 2655 CDS 100% 4.950 6.930 N Dip2b n/a
2 TRCN0000098715 GCCAGCTAACACGTTACCAAA pLKO.1 2050 CDS 100% 4.950 6.930 N Dip2b n/a
3 TRCN0000098718 CCCTATCTATGTGGCTTACAA pLKO.1 4057 CDS 100% 5.625 3.938 N Dip2b n/a
4 TRCN0000098716 CGTATCTTGATTTCAGCGTTT pLKO.1 2814 CDS 100% 4.050 2.835 N Dip2b n/a
5 TRCN0000098717 GCTTTCTGAATCTGGAAAGAT pLKO.1 3436 CDS 100% 0.563 0.394 N Dip2b n/a
6 TRCN0000121660 GAAGAGCATTACCTCATCGTT pLKO.1 3935 CDS 100% 3.000 2.100 N DIP2B n/a
7 TRCN0000121734 CCATTCTCTCAATGAATGGAT pLKO.1 1437 CDS 100% 0.300 0.210 N DIP2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172819.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.