Transcript: Mouse NM_172824.3

Mus musculus coiled-coil domain containing 14 (Ccdc14), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ccdc14 (239839)
Length:
4107
CDS:
43..2847

Additional Resources:

NCBI RefSeq record:
NM_172824.3
NBCI Gene record:
Ccdc14 (239839)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172824.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180834 GCTGGATCTTACGAGTTGTAT pLKO.1 1002 CDS 100% 5.625 7.875 N Ccdc14 n/a
2 TRCN0000179114 CTGGATCTTACGAGTTGTATT pLKO.1 1003 CDS 100% 13.200 9.240 N Ccdc14 n/a
3 TRCN0000181044 CCTGGAGCTAAGTTACCAAAT pLKO.1 238 CDS 100% 10.800 7.560 N Ccdc14 n/a
4 TRCN0000183926 CCAAACACACACGTCTCTGTT pLKO.1 1071 CDS 100% 4.950 2.970 N Ccdc14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172824.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.