Transcript: Mouse NM_172872.3

Mus musculus KN motif and ankyrin repeat domains 4 (Kank4), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Kank4 (242553)
Length:
4801
CDS:
180..3230

Additional Resources:

NCBI RefSeq record:
NM_172872.3
NBCI Gene record:
Kank4 (242553)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172872.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428111 ATGCCACAATCGGGCAGTATG pLKO_005 1867 CDS 100% 10.800 15.120 N Kank4 n/a
2 TRCN0000099586 CGACCAGCCTTAAATCCATAA pLKO.1 2137 CDS 100% 10.800 15.120 N Kank4 n/a
3 TRCN0000446051 GAGTGCACTGTAGCCCATTTA pLKO_005 1350 CDS 100% 13.200 10.560 N Kank4 n/a
4 TRCN0000417842 GGGAACTAGAGCCAGCAATTC pLKO_005 841 CDS 100% 10.800 8.640 N Kank4 n/a
5 TRCN0000444295 GAGCCAAGCAGGCTAAGTTTA pLKO_005 358 CDS 100% 13.200 9.240 N Kank4 n/a
6 TRCN0000423239 TCAAGTGTGTATACAAATATG pLKO_005 3615 3UTR 100% 13.200 9.240 N Kank4 n/a
7 TRCN0000099585 GCACAGTACATTCCCATCATA pLKO.1 3337 3UTR 100% 5.625 3.938 N Kank4 n/a
8 TRCN0000099587 CCTCAAATATGTGGATGACAT pLKO.1 296 CDS 100% 4.950 3.465 N Kank4 n/a
9 TRCN0000150287 GAGAGATATAAACCCTCAGAA pLKO.1 2451 CDS 100% 4.950 6.930 N KANK4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172872.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.