Transcript: Mouse NM_172916.2

Mus musculus HYDIN, axonemal central pair apparatus protein (Hydin), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Hydin (244653)
Length:
15783
CDS:
123..15587

Additional Resources:

NCBI RefSeq record:
NM_172916.2
NBCI Gene record:
Hydin (244653)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172916.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217077 CTTCAACGTGGACGTGATAAA pLKO.1 13307 CDS 100% 13.200 18.480 N Hydin n/a
2 TRCN0000177634 CCAGAAGTCTATGATTACTTT pLKO.1 5940 CDS 100% 5.625 7.875 N Hydin n/a
3 TRCN0000181800 GCGACTCATAGTCCAAGACTA pLKO.1 4913 CDS 100% 4.950 6.930 N Hydin n/a
4 TRCN0000181445 CCATCGTCTTAGAAGCCCTAT pLKO.1 6436 CDS 100% 4.050 5.670 N Hydin n/a
5 TRCN0000176756 CCTAAAGAAGTCTGTAAACTA pLKO.1 13662 CDS 100% 5.625 4.500 N Hydin n/a
6 TRCN0000197754 GCAGAAGAGAAAGTTGCATTT pLKO.1 7170 CDS 100% 10.800 7.560 N Hydin n/a
7 TRCN0000198377 GCTGTGTAATTGGACCTACAT pLKO.1 1933 CDS 100% 4.950 3.465 N Hydin n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172916.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.