Transcript: Mouse NM_172924.3

Mus musculus pseudopodium-enriched atypical kinase 1 (Peak1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Peak1 (244895)
Length:
10994
CDS:
453..5660

Additional Resources:

NCBI RefSeq record:
NM_172924.3
NBCI Gene record:
Peak1 (244895)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172924.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338043 CCTAAACGCTGGATATCATTT pLKO_005 3213 CDS 100% 13.200 18.480 N Peak1 n/a
2 TRCN0000338042 GCTAATCCCACCTACGATATT pLKO_005 3969 CDS 100% 13.200 18.480 N Peak1 n/a
3 TRCN0000088552 CGGGCTAACTGAAGTGCTAAA pLKO.1 896 CDS 100% 10.800 8.640 N Peak1 n/a
4 TRCN0000338111 ACAGACTCCCTGAGCTATATT pLKO_005 5616 CDS 100% 15.000 10.500 N Peak1 n/a
5 TRCN0000362748 AGCAGAAACTGAGTCTAATTT pLKO_005 1595 CDS 100% 15.000 10.500 N Peak1 n/a
6 TRCN0000362683 ATCCTGCAATACCGTTAATAT pLKO_005 5643 CDS 100% 15.000 10.500 N Peak1 n/a
7 TRCN0000088549 CCCTGTTAAGTCACCTAATTT pLKO.1 2192 CDS 100% 15.000 10.500 N Peak1 n/a
8 TRCN0000195001 CCCTGTTAAGTCACCTAATTT pLKO.1 2192 CDS 100% 15.000 10.500 N PEAK1 n/a
9 TRCN0000338040 TGGTATCCACTCAGAATTTAA pLKO_005 5730 3UTR 100% 15.000 10.500 N Peak1 n/a
10 TRCN0000338041 ATCACGGCCACCCAGTATAAG pLKO_005 5163 CDS 100% 13.200 9.240 N Peak1 n/a
11 TRCN0000362684 CCCTAGAGGACATCCCATTAT pLKO_005 6126 3UTR 100% 13.200 9.240 N Peak1 n/a
12 TRCN0000088550 GCTACAAACATCTCCTCTAAA pLKO.1 2166 CDS 100% 13.200 9.240 N Peak1 n/a
13 TRCN0000088551 CCCGATCAACAGAAGCTGAAT pLKO.1 3148 CDS 100% 4.950 3.465 N Peak1 n/a
14 TRCN0000088548 CCATCACAGATTCCTGACAAA pLKO.1 3540 CDS 100% 4.950 2.970 N Peak1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172924.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.