Transcript: Mouse NM_172937.3

Mus musculus SNF2 histone linker PHD RING helicase (Shprh), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Shprh (268281)
Length:
7385
CDS:
196..5046

Additional Resources:

NCBI RefSeq record:
NM_172937.3
NBCI Gene record:
Shprh (268281)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172937.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084265 CGTGGCAAGATGTATTAGATA pLKO.1 4775 CDS 100% 5.625 7.875 N Shprh n/a
2 TRCN0000298420 CGTGGCAAGATGTATTAGATA pLKO_005 4775 CDS 100% 5.625 7.875 N Shprh n/a
3 TRCN0000084266 GCAGGCATTCACATCATTAAA pLKO.1 3259 CDS 100% 15.000 10.500 N Shprh n/a
4 TRCN0000288210 GCAGGCATTCACATCATTAAA pLKO_005 3259 CDS 100% 15.000 10.500 N Shprh n/a
5 TRCN0000295572 GGTTGAACAGAATCGTATAAA pLKO_005 4320 CDS 100% 15.000 10.500 N Shprh n/a
6 TRCN0000295510 TTTGAGGAAAGGGTCTATATT pLKO_005 5274 3UTR 100% 15.000 10.500 N Shprh n/a
7 TRCN0000084267 GCACTATATGAGTAAGTGTAA pLKO.1 3480 CDS 100% 4.950 3.465 N Shprh n/a
8 TRCN0000288277 GCACTATATGAGTAAGTGTAA pLKO_005 3480 CDS 100% 4.950 3.465 N Shprh n/a
9 TRCN0000084263 GCCTTGAATGTTTGAAGACAT pLKO.1 5600 3UTR 100% 4.950 3.465 N Shprh n/a
10 TRCN0000084863 CCTGAGTTCAATTCCCAGTAA pLKO.1 6150 3UTR 100% 4.950 2.475 Y Zfp9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172937.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.