Transcript: Mouse NM_173028.4

Mus musculus vacuolar protein sorting 13A (Vps13a), mRNA.

Source:
NCBI, updated 2019-04-02
Taxon:
Mus musculus (mouse)
Gene:
Vps13a (271564)
Length:
11178
CDS:
165..9665

Additional Resources:

NCBI RefSeq record:
NM_173028.4
NBCI Gene record:
Vps13a (271564)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173028.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177418 GCAGCTACATTCCTATTAATA pLKO.1 7374 CDS 100% 15.000 21.000 N Vps13a n/a
2 TRCN0000177844 CGGGATTTCACTTGTCAATAA pLKO.1 7736 CDS 100% 13.200 18.480 N Vps13a n/a
3 TRCN0000181823 GCTATGGTGAAGTAACCCATA pLKO.1 7537 CDS 100% 0.405 0.567 N Vps13a n/a
4 TRCN0000381910 TGAAGGCCTGCAGCGTATTAT pLKO_005 7619 CDS 100% 15.000 12.000 N Vps13a n/a
5 TRCN0000198098 CCGTTTACAGATGTCAGTATT pLKO.1 8184 CDS 100% 13.200 10.560 N Vps13a n/a
6 TRCN0000381277 CCGAAAGCATCCACCTAATTA pLKO_005 6842 CDS 100% 15.000 10.500 N Vps13a n/a
7 TRCN0000380164 GAACTGGAAGTTCACTATTAT pLKO_005 5448 CDS 100% 15.000 10.500 N Vps13a n/a
8 TRCN0000176906 GCCTCCAATATTCTTCTTATT pLKO.1 7194 CDS 100% 13.200 9.240 N Vps13a n/a
9 TRCN0000181885 GCGATGGTTCAGGAAATCAAA pLKO.1 9301 CDS 100% 5.625 3.938 N Vps13a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173028.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.