Transcript: Mouse NM_173182.2

Mus musculus fibronectin type III domain containing 3B (Fndc3b), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Fndc3b (72007)
Length:
6875
CDS:
123..3746

Additional Resources:

NCBI RefSeq record:
NM_173182.2
NBCI Gene record:
Fndc3b (72007)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173182.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120524 CCGTGCAATAATGGGTCTGAA pLKO.1 2808 CDS 100% 4.950 6.930 N Fndc3b n/a
2 TRCN0000120523 CGTGCAATAATGGGTCTGAAA pLKO.1 2809 CDS 100% 4.950 6.930 N Fndc3b n/a
3 TRCN0000120526 CGGATTACCATGTGAGGGTAT pLKO.1 1177 CDS 100% 4.050 5.670 N Fndc3b n/a
4 TRCN0000419615 AGCGAAGCACACAGTATAAAT pLKO_005 1747 CDS 100% 15.000 10.500 N Fndc3b n/a
5 TRCN0000432002 CAGTCCTTAGAACTCGTTTAT pLKO_005 2556 CDS 100% 13.200 9.240 N Fndc3b n/a
6 TRCN0000229812 CATGTGCCTCCAGGTTATATC pLKO_005 360 CDS 100% 13.200 9.240 N FNDC3B n/a
7 TRCN0000433302 TTTACGCTGTTTCGTTCTTTG pLKO_005 3816 3UTR 100% 10.800 7.560 N Fndc3b n/a
8 TRCN0000120522 CGCCATTATTTGCTATTCATT pLKO.1 6149 3UTR 100% 5.625 3.938 N Fndc3b n/a
9 TRCN0000120525 CCCATTTGAAACCAGGCACTT pLKO.1 2035 CDS 100% 4.050 2.835 N Fndc3b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173182.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.