Transcript: Human NM_173215.3

Homo sapiens nuclear factor of activated T cells 5 (NFAT5), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
NFAT5 (10725)
Length:
5326
CDS:
627..4994

Additional Resources:

NCBI RefSeq record:
NM_173215.3
NBCI Gene record:
NFAT5 (10725)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173215.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020022 GCAGCAGATTTCATCAAATAT pLKO.1 2660 CDS 100% 15.000 10.500 N NFAT5 n/a
2 TRCN0000020020 GCAGAGTAACTGGACGAAATA pLKO.1 1438 CDS 100% 13.200 9.240 N NFAT5 n/a
3 TRCN0000437810 GTGGACTGCGTAGGGATATTG pLKO_005 1542 CDS 100% 13.200 9.240 N NFAT5 n/a
4 TRCN0000020023 CGGACAACAAAGGCAACTCAA pLKO.1 1123 CDS 100% 4.950 3.465 N NFAT5 n/a
5 TRCN0000020019 GCCCAGATTCAGTCAGAGTTA pLKO.1 3123 CDS 100% 4.950 3.465 N NFAT5 n/a
6 TRCN0000020021 CCGAACTCAATTTCTCCACTT pLKO.1 3888 CDS 100% 4.050 2.835 N NFAT5 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5205 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173215.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.