Transcript: Mouse NM_173375.1

Mus musculus family with sequence similarity 180, member A (Fam180a), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Fam180a (208164)
Length:
1528
CDS:
228..749

Additional Resources:

NCBI RefSeq record:
NM_173375.1
NBCI Gene record:
Fam180a (208164)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173375.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181736 GATAACATTAACCCTGGCGTA pLKO.1 602 CDS 100% 2.160 3.024 N Fam180a n/a
2 TRCN0000198828 CCCACACAGAATAGCAAAGAT pLKO.1 848 3UTR 100% 5.625 3.938 N Fam180a n/a
3 TRCN0000197543 CCCTATCATTTCAATGTAGAA pLKO.1 1294 3UTR 100% 4.950 3.465 N Fam180a n/a
4 TRCN0000178337 GTTTCCACTCAATCTGCAATA pLKO.1 490 CDS 100% 10.800 6.480 N Fam180a n/a
5 TRCN0000178488 GAAAGAAGACTTTGAGAGGAT pLKO.1 584 CDS 100% 2.640 1.584 N Fam180a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173375.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.