Transcript: Mouse NM_173440.2

Mus musculus nuclear receptor interacting protein 1 (Nrip1), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Nrip1 (268903)
Length:
4529
CDS:
724..4209

Additional Resources:

NCBI RefSeq record:
NM_173440.2
NBCI Gene record:
Nrip1 (268903)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173440.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096506 CGGTCTGATTGATAGATTAAA pLKO.1 2715 CDS 100% 15.000 21.000 N Nrip1 n/a
2 TRCN0000366849 TAAGTGGGTCATCGCAGATAT pLKO_005 3855 CDS 100% 13.200 18.480 N Nrip1 n/a
3 TRCN0000366790 TTACCTCGAAGGGTTACTAAT pLKO_005 780 CDS 100% 13.200 18.480 N Nrip1 n/a
4 TRCN0000375671 CCGATAACAACCCGAGCTTTA pLKO_005 1979 CDS 100% 10.800 15.120 N Nrip1 n/a
5 TRCN0000375722 CAGTTGCTGCTCGGCCATAAA pLKO_005 2230 CDS 100% 13.200 10.560 N Nrip1 n/a
6 TRCN0000096508 GCCGTAGATACTGCCAATCAT pLKO.1 3355 CDS 100% 5.625 4.500 N Nrip1 n/a
7 TRCN0000366791 GCAGGAATGAGCTCGATTATA pLKO_005 3434 CDS 100% 15.000 10.500 N Nrip1 n/a
8 TRCN0000375672 GATGTGCATCAGGATTCTATT pLKO_005 751 CDS 100% 13.200 9.240 N Nrip1 n/a
9 TRCN0000096504 GCCATACCACTTTGGGTCTTT pLKO.1 4220 3UTR 100% 4.950 3.465 N Nrip1 n/a
10 TRCN0000019782 GCTGCAAGATTACAGGCTGTT pLKO.1 1435 CDS 100% 4.050 2.835 N NRIP1 n/a
11 TRCN0000096505 GCTGTCTGATTCCATCGTGAA pLKO.1 1023 CDS 100% 4.050 2.835 N Nrip1 n/a
12 TRCN0000096507 GCTGCTAATAACAGTCTGCTT pLKO.1 1849 CDS 100% 2.640 1.848 N Nrip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173440.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.