Transcript: Human NM_173601.2

Homo sapiens glucoside xylosyltransferase 1 (GXYLT1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
GXYLT1 (283464)
Length:
7492
CDS:
229..1551

Additional Resources:

NCBI RefSeq record:
NM_173601.2
NBCI Gene record:
GXYLT1 (283464)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173601.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245879 CTTGACCTGTTAGCTAATATA pLKO_005 2736 3UTR 100% 15.000 21.000 N GXYLT1 n/a
2 TRCN0000257705 CCTCGAATAGGATGGTATAAT pLKO_005 979 CDS 100% 15.000 10.500 N GXYLT1 n/a
3 TRCN0000245878 AGACTTGACAACTGGTCATTT pLKO_005 712 CDS 100% 13.200 9.240 N GXYLT1 n/a
4 TRCN0000245877 AGATTGTTCTTGCCGTTAATC pLKO_005 826 CDS 100% 13.200 9.240 N GXYLT1 n/a
5 TRCN0000245876 CTTTGCTAGGCATCCATATTA pLKO_005 1002 CDS 100% 15.000 9.000 N GXYLT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173601.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09944 pDONR223 100% 99.9% 99.7% None 631G>A n/a
2 ccsbBroad304_09944 pLX_304 0% 99.9% 99.7% V5 631G>A n/a
3 TRCN0000475752 ACCTACACTGGTCACGGAGATTGT pLX_317 21.9% 99.9% 99.7% V5 631G>A n/a
Download CSV