Transcript: Human NM_173631.3

Homo sapiens zinc finger protein 547 (ZNF547), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
ZNF547 (284306)
Length:
2876
CDS:
282..1490

Additional Resources:

NCBI RefSeq record:
NM_173631.3
NBCI Gene record:
ZNF547 (284306)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173631.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423654 AGCCTTCAGTCACCAACATAT pLKO_005 1520 3UTR 100% 13.200 9.240 N ZNF547 n/a
2 TRCN0000015791 AGTGCAACTCAAACCTCTTTA pLKO.1 1114 CDS 100% 13.200 9.240 N ZNF547 n/a
3 TRCN0000425287 ACACTGGATAAGGCCCTTATG pLKO_005 1480 CDS 100% 10.800 7.560 N ZNF547 n/a
4 TRCN0000015792 CTCATTTGTCATCAGACAGTT pLKO.1 1380 CDS 100% 4.950 3.465 N ZNF547 n/a
5 TRCN0000015790 TGGGAAATTCTTCAGCTTGAA pLKO.1 1268 CDS 100% 4.950 3.465 N ZNF547 n/a
6 TRCN0000015788 CCTTACAAAGTCCCACCTCAT pLKO.1 1364 CDS 100% 4.050 2.835 N ZNF547 n/a
7 TRCN0000015789 CCTGTCTATCTACCCAGAATA pLKO.1 517 CDS 100% 13.200 7.920 N ZNF547 n/a
8 TRCN0000426931 GATGGAGGAAGACCGACATTT pLKO_005 690 CDS 100% 13.200 7.920 N ZNF547 n/a
9 TRCN0000420675 GATGTGATGCTGGAGAATTTC pLKO_005 393 CDS 100% 13.200 6.600 Y Zfp874a n/a
10 TRCN0000107857 GCAGTGAATGTGGGAAGTTAT pLKO.1 1090 CDS 100% 13.200 6.600 Y ZNF773 n/a
11 TRCN0000012945 GCAGTGAATGTGGGAAAGCTT pLKO.1 754 CDS 100% 3.000 1.500 Y ZNF146 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173631.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.