Transcript: Human NM_173685.4

Homo sapiens NSE2 (MMS21) homolog, SMC5-SMC6 complex SUMO ligase (NSMCE2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
NSMCE2 (286053)
Length:
1188
CDS:
210..953

Additional Resources:

NCBI RefSeq record:
NM_173685.4
NBCI Gene record:
NSMCE2 (286053)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173685.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167431 GATCGGCAACTAAACCATTAT pLKO.1 423 CDS 100% 13.200 18.480 N NSMCE2 n/a
2 TRCN0000167618 GAAGATATAATTGTGACCCAA pLKO.1 675 CDS 100% 2.640 3.696 N NSMCE2 n/a
3 TRCN0000419927 AGGAGTGGATGAAGATATAAT pLKO_005 665 CDS 100% 15.000 10.500 N NSMCE2 n/a
4 TRCN0000429980 GACAAGGCAATGGTTGAATTT pLKO_005 393 CDS 100% 13.200 9.240 N NSMCE2 n/a
5 TRCN0000168128 GAAGGGCAATTGAGAACCATA pLKO.1 904 CDS 100% 4.950 3.465 N NSMCE2 n/a
6 TRCN0000168516 GTGAAAGAAGAACGTCCAGAA pLKO.1 474 CDS 100% 4.050 2.835 N NSMCE2 n/a
7 TRCN0000435575 AGCTGTCTGTTGAGAGCAGTG pLKO_005 1001 3UTR 100% 2.250 1.575 N NSMCE2 n/a
8 TRCN0000168834 CAGACTGAAGTGAGTAGTGAA pLKO.1 363 CDS 100% 4.950 2.970 N NSMCE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173685.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.