Transcript: Mouse NM_173739.3

Mus musculus UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18 (Galnt18), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Galnt18 (233733)
Length:
2595
CDS:
431..2299

Additional Resources:

NCBI RefSeq record:
NM_173739.3
NBCI Gene record:
Galnt18 (233733)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173739.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110317 GCCCTCATTGGCTGTTTCATT pLKO.1 1415 CDS 100% 5.625 3.938 N Galnt18 n/a
2 TRCN0000110316 GCTGACTGAATATGTGGACAA pLKO.1 1042 CDS 100% 4.050 2.835 N Galnt18 n/a
3 TRCN0000110319 TCATGTCTACATGGCATGGAA pLKO.1 1720 CDS 100% 3.000 2.100 N Galnt18 n/a
4 TRCN0000110315 CGCTTTGCTACTGTGTAGCAT pLKO.1 2324 3UTR 100% 0.300 0.210 N Galnt18 n/a
5 TRCN0000110318 CGTGTACATATGCCATGGGAT pLKO.1 1957 CDS 100% 0.000 0.000 N Galnt18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173739.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.