Transcript: Mouse NM_173771.4

Mus musculus MGAT4 family, member F (Mgat4f), mRNA.

Source:
NCBI, updated 2019-09-11
Taxon:
Mus musculus (mouse)
Gene:
Mgat4f (240755)
Length:
1770
CDS:
279..1718

Additional Resources:

NCBI RefSeq record:
NM_173771.4
NBCI Gene record:
Mgat4f (240755)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173771.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430850 TATCGCAGCAGCACATGTAAA pLKO_005 377 CDS 100% 13.200 18.480 N Mgat4f n/a
2 TRCN0000093641 GTTGCCAACATTTCAGGTCTT pLKO.1 738 CDS 100% 4.050 3.240 N Mgat4f n/a
3 TRCN0000438292 GAACAGGACCTGGAGTATATG pLKO_005 666 CDS 100% 13.200 9.240 N Mgat4f n/a
4 TRCN0000093642 GTGATGGAGATTAGTTGTATA pLKO.1 1599 CDS 100% 13.200 9.240 N Mgat4f n/a
5 TRCN0000423655 TCTTGCCCTTCTCATGAATTT pLKO_005 881 CDS 100% 13.200 9.240 N Mgat4f n/a
6 TRCN0000093639 CCTCAACCTCTCTGAATACTT pLKO.1 905 CDS 100% 5.625 3.938 N Mgat4f n/a
7 TRCN0000093643 ACCATTGGTGAGAGGTCAGTT pLKO.1 1547 CDS 100% 4.950 3.465 N Mgat4f n/a
8 TRCN0000093640 CTCTACTAAGAATAGGTTGAA pLKO.1 1445 CDS 100% 4.950 3.465 N Mgat4f n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173771.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.